In mammalian systems RNA can move between cells via vesicles. Here we demonstrate that the gastrointestinal nematode Heligmosomoides polygyrus, which infects mice, secretes vesicles containing microRNAs (miRNAs) and Y RNAs as well as a nematode Argonaute protein.

These vesicles are of intestinal origin and are enriched for homologues of mammalian exosome proteins. Administration of the nematode exosomes to mice suppresses Type 2 innate responses and eosinophilia induced by the allergen Alternaria.

The miR-34 mutant brain displays a gene expression profile of accelerated. For log2-fold-change magnitude, as noted in the legend on right).

Microarray analysis of mouse cells incubated with nematode exosomes in vitro identifies Il33r and Dusp1 as suppressed genes, and Dusp1 can be repressed by nematode miRNAs based on a reporter assay. We further identify miRNAs from the filarial nematode Litomosoides sigmodontis in the serum of infected mice, suggesting that miRNA secretion into host tissues is conserved among parasitic nematodes. These results reveal exosomes as another mechanism by which helminths manipulate their hosts and provide a mechanistic framework for RNA transfer between animal species. Parasitic nematodes are ubiquitous pathogens of plants and animals, including species that infect over 2 billion people and generally reside in extracellular niches in their hosts. Polygyrus is a parasite related to human hookworm that naturally infects mice, and is in the same nematode clade as Caenorhabditis elegans. Within the mouse host, the parasite life cycle is exclusively intestinal: following ingestion, the larvae invade the small intestine, moult into adult worms and emerge into the lumen of the duodenum to mate and to produce eggs expelled in the faeces.

The infection induces Type 2 innate and adaptive (Th2) immune responses in parallel with a large expansion of regulatory cells that mediate immunosuppressive effects, some of which have beneficial properties in allergy and auto-immunity. Immune suppression has been shown to be mediated in part by a suite of immunomodulatory proteins actively secreted by the nematodes. Given the burgeoning body of data detailing extracellular small RNAs in mammalian systems, and emerging evidence that these can mediate cell-to-cell communication, it is intriguing to think this mechanism could also be used by parasites. Small RNAs derived from bacteria, plants and parasites have been detected in human body fluids,; however, the mechanism by which these are secreted or excreted is unknown, and the meaning of their extracellular existence unclear.

We show here that H. Polygyrus secretes a specific set of miRNAs and full-length Y RNAs that are stabilized against degradation by encapsulation within vesicles. The vesicles are of intestinal origin and are enriched for homologues of mammalian proteins found in exosomes, including heat shock proteins, tetraspanins and ALIX, a protein associated with exosome biogenesis, as well as a nematode Argonaute (Ago) protein. Local administration of the nematode exosomes to mice by the intranasal route suppresses Type 2 innate responses and eosinophilia induced by the allergen Alternaria in vivo.

The nematode vesicles are internalized by mouse intestinal epithelial cells in vitro and suppress genes involved in inflammation and immunity, including the receptor for the alarmin IL-33 and a key regulator of mitogen-activated protein kinase (MAPK) signalling, DUSP1. This work identifies exosomes as a new class of immunomodulatory complex produced by helminths and provides the first steps towards a mechanistic framework for RNA-mediated communication between animal species. Small RNAs in H. Polygyrus secretory productsTotal RNA was extracted from the secretory products of H. Polygyrus and compared with the profile of small RNAs in adult nematodes, eggs and infective larvae.

A heterogeneous population of small RNAs. Polygyrus secretory products contain miRNAs and Y RNAs.( a) Size distribution of 3′-end labelled (pCp) total RNA extracted from the life stages (1 μg total RNA) or secretion product of H. Polygyrus (total RNA from equivalent of 15 μg protein secretion product). ( b) Proportion of H.

Polygyrus small RNA biotypes (. Many secreted nematode miRNAs have identical seed sites to mouse miRNAs.( a) Temporal expression of highly abundant miRNAs (10,000 reads per million in at least one of the libraries) across the life stages. Nematode and mouse names are listed according to identical seed sites and miRNAs of high abundance in the secretion product are coloured according to their conservation level: Eumetazoa (red), Bilateria (blue), Protostomia (green), Nematoda (orange). ( b) Sequence alignment of abundant secreted parasite miRNAs that contain identical seed sites between mouse and H. Polygyrus; all families shown are of common ancestry apart from miR-425/63. Nematode vesicles are associated with secreted RNAIn mammalian systems, miRNAs have been found in body fluids in association with specific proteins or in extracellular vesicles.

To determine whether these RNAs could be present in vesicles, the H. Polygyrus secretory products were ultracentrifuged and quantitative reverse transcription–PCR (qRT)–PCR used to measure miRNA levels in the pellet and supernatant, revealing the majority to be present in the pellet. Transmission electron microscopy (TEM) identified vesicle-like structures between 50 and 100 nm in diameter in the pelleted material. Label-free quantification of proteins in the vesicles and supernatant by liquid chromatography-electrospray tandem mass spectrometry LC-MS/MS identified 362 proteins, of which 139 were specifically enriched in the vesicle fraction ( P. Polygyrus secretes exosomes of intestinal origin that contain a WAGO protein.( a) TEM of purified ultracentrifugation pellet (100 μg ml −1 total protein) from H.

Polygyrus secretion product, scale indicates 0.5 μm. ( b) Scatter plot of proteins enriched in ultracentrifugation pellet or supernatant based on LC-MS/MS, n=3, using P1.5 as cutoffs. Noted in the legend are homologues of intestinal nematode proteins (green), mammalian exosome proteins (purple), Venom Allergen-Like (VAL) proteins (orange) and an Argonaute protein (red). ( c) TEM of adult worm intestine noting vesicles of comparable size to exosomes, scale indicates 1.0 μm.

Bump on the roof of mouth is one of the dental conditions frequently seen by the dentist. Bump on roof of mouth.

( d) Phylogenetic relationship of the secreted Argonaute protein identified in H. Polygyrus secretion product in relation to other nematode Argonautes. The analysis was performed on the same data set described in ref. With the addition of the H. Polygyrus-secreted argonaute sequence, using the same method (Bayesian analysis using MrBayes v3.2). Nematode RNAs are protected from degradation by exosomesTo determine which RNAs identified in the total secretion product are specifically associated with vesicles, small RNA sequencing of replicate vesicle and nonvesicle (supernatant) fractions of the secretion product was carried out. Results from three biological replicates demonstrate that the parasite miRNAs are enriched in the vesicle fractions (75% of reads compared with 10% in supernatant, which is dominated instead by rRNA and Y RNA fragments, ).

This analysis also identified three mouse miRNA homologues: miR-193, miR-10 and miR-200, within the top five most abundant secreted miRNAs. These were ranked much lower in the initial Illumina analysis likely because of the sequencing bias of the different kits and platforms, underscoring the importance of comparing both approaches.

Overall the three replicates showed the same profile of miRNAs in each vesicle sample and neither vesicle nor supernatant contained intact large ribosomal RNA. Northern blot analysis confirmed the specificity of small RNA biotypes in vesicles versus supernatant, showing miR-100 to be exclusively present in the vesicles and the Y RNA fragment to be exclusively present in the supernatant. Notably, on the same blot the full-length Y RNA was detected in the vesicles and both the miRNA and full-length Y RNA were largely resistant to degradation by RNases in untreated samples but became susceptible in the presence of Triton-X-100. Together, these results demonstrate that mature miRNAs and full-length Y RNAs are secreted by a parasitic nematode and are protected through encapsulation within vesicles of intestinal origin that share similar size and protein composition to mammalian exosomes. Secreted miRNAs are protected from degradation through encapsulation within exosomes.( a) Classification of H.

Polygyrus small RNAs in the secretion product following ultracentrifugation. ( b) Northern blot analysis of RNA extracted from ultracentrifuge pellet or supernatant (from equivalent 10 μg protein) using probes complementary to H. Polygyrus miR-100 or the 5′ arm of nematode Y RNA;. indicates the processed Y RNA and. indicates the full length Y RNA. ( c) Northern blot of RNA extracted from the pelleted secretion product following RNase treatment (0.5 Unit RNace-IT, 1 h at 37 °C) in the presence or absence of 0.05% Triton-X-100.

Polygyrus exosomes suppress innate immunity in vivoHelminths are well known to suppress pathogenic immune responses in both the gastrointestinal tract and airways. To examine the functionality of the parasite-derived exosomes in vivo, they were administered intranasally in combination with extracts of the allergenic fungus Alternaria, which induces rapid IL-33 release as part of the Type 2 Th2-like innate immune response that leads to lung eosinophilia. Pre-treatment with parasite-derived exosomes before Alternaria extract administration led to a sharp reduction in bronchoalveolar lavage eosinophilia , and suppressed expression of the Type 2 cytokines interleukin (IL)-5 and IL-13 by innate lymphoid cells (ILCs; ). Neutrophilia, which does not depend on Type 2 cytokines, was undiminished by exosome administration.

Intriguingly, the overall expression of the IL-33 receptor (also known as ST2) was also suppressed in recipients of exosomes. Polygyrus exosomes suppress a Type 2 innate immune response in vivo.H.

Polygyrus exosomes (10 μg) were administered intranasally to BALB/c mice 24 h before administration of 50 μg Alternaria extract and a further 5 μg exosomes, or controls that received PBS. ( a) Siglecf +CD11c − eosinophils in the bronchoalveolar lavage; ( b) IL-5 and ( c) IL-13 expression in PMA/ionomycin-stimulated lineage-negative, ICOS +ST2 + group 2 innate lymphoid cells in digested lung tissue were measured 24 h after Alternaria extract administration; ( d) Gr1+CD11b+ neutrophils in the same lavage samples; ( e) the mean fluorescence intensity (MFI) of ST2 (IL33R) staining in ILCs from each group of mice.

Data are representative of two independent experiments, n=4–6 per group; error bars are mean±s.e.m. Data analysed by ANOVA and Tukey’s post test,. P. Internalization of nematode exosomes and RNAs by mouse cellsTo determine whether the nematode-derived exosomes can enter mammalian cells, uptake was examined in mouse small intestinal epithelial cells, a cell type that is naturally in direct contact with H.

Polygrus in vivo. Exosomes were labelled with the lipid dye PKH67 and incubated with MODE-K cells in vitro. Uptake was analysed by fluorescence-activated cell sorting (FACS) and confocal microscopy.

Over 60% of the cells were PKH67-positive after 1 h of incubation with H. Polygyrus vesicles compared with 1.5% when incubated with background dye. These results are unlikely to be due to nonspecific association with the cell membrane as treatment with trypsin did not eliminate the signal. Confocal analysis confirmed uptake to the cytoplasm and demonstrates that this requires physiological temperature. QRT–PCR analysis of the treated cells detects the parasite-specific miRNAs in cells after 20 h of incubation, with no change in the endogenous miR-16.

The full-length parasite-derived Y RNA could also be detected by northern blot analysis in cells which were treated directly with exosomes followed by washing. Polygyrus exosomes and RNAs are internalized by mouse cells.( a) Confocal analysis of murine epithelial cells incubated for 1 h with PKH67-labelled H. Polygyrus exosomes at 37 and 4 °C, scale indicates 8.0 μM. ( b) Relative expression of parasite-derived miRNAs in murine epithelial cells at 20 h post incubation with 5 μg H.

Polygyrus exosomes following PBS washes. Signal observed in untreated host cells represents the background detection of the probe; for parasite-derived miRNA, the data are normalized to the input detection level of miRNAs in 5 μg of exosomes, whereas miR-16 levels in exosome-treated cells are normalized to untreated cells. ( c) Northern blot analysis of RNA extracted from murine epithelial cells following 20 h incubation with H.

Polygyrus exosomes (5 μg total protein) compared with untreated cells following PBS washes, using a probe against the loop of the nematode Y RNA or mouse miR-16. Regulation of mouse genes by nematode exosomesTo determine the function of these vesicles in mouse cells, gene expression analyses were carried out on MODE-K cells following incubation with H.

Polygyrus exosomes. A total of 128 genes were differentially expressed upon treatment (false discovery rate (FDR) P. Mouse Il33r and Dusp1 are suppressed by H. Polygyrus exosomes and the secreted miRNA repress target sites in Dusp1.( a) Volcano plot of mouse genes up- or downregulated upon incubation with H. Polygyrus-derived exosomes; red=FDR P30%. ( b) Levels of Dusp1 and Il1rl1 in mouse epithelial cells (5 × 10 4) following 48 h treatment with 5 μg H.

Polygyrus exosomes or MODE-K-derived exosomes, n=8, error bars are mean±s.e.m. Data analysed by ANOVA and Tukey’s post test,. P. Circulating nematode miRNAs in serumTo establish whether the secreted nematode miRNAs naturally circulate in host tissues in vivo, we examined serum from mice infected with H. Polygyrus (which resides in the gut lumen) or the filarial nematode L.

Sigmodontis (which resides in the pleural cavity). Polygyrus miRNAs were detected in the serum; however, a total of 1,188 reads mapped perfectly and unambiguously to the L.

Sigmodontis draft genome and 761 of these derived from 16 nematode miRNAs ( and ). Although we cannot rule out the possibility that some of the miRNAs in serum could derive from dying worms, the most abundant miRNAs detected are homologues of those found in H. Polygyrus exosomes, including miR-100, bantam, miR-71 and miR-263 (, ).

These data confirm the in vivo secretion of parasite miRNAs and are consistent with the idea that exosomes and associated RNAs operate locally in the host’s body such that their detection in body fluids will be dictated by the life stage and localization of the parasite in the host. NameMature sequenceNumber of reads (infected)miR-100aUACCCGUAGCUCCGAAUAUGUGU479miR-86UAAGUGAAUGCUUUGCCACAGUCU57Bantam-aUGAGAUCAUUGUGAAAGCUAUU45Bantam-bUGAGAUCACGUUACAUCCGCCU45miR-100bAACCCGUAGUUUCGAACAUGUGU40miR-71UGAAAGACAUGGGUAGUGAGACG32miR-100cAACCCGUAGAAUUGAAAUCGUGU22miR-50-5pUGAUAUGUCUGAUAUUCUUGGGUU10miR-34-5pUGGCAGUGUGGUUAGCUGGUUGU8miR-263/183AAUGGCACUAGAUGAAUUCACGG7Bantam-cUGAGAUCAUGCCACAUCCGUCU4miR-50-3pCCAGCAUCUCAGACGUAUCGGC3miR-153UUGCAUAGUCACAAAAGUGAUG3miR-87-5pCGCCUGGGACUUCGACUCAACCU2miR-2UAUCACAGCCAGCUUUGAUGU2miR-5866UUACCAUGUUGAUCGAUCUCC2. DiscussionIn summary, we have shown that nematode parasite-derived miRNAs and Y RNAs are transported into mammalian host cells via exosomes that regulate host genes associated with immunity and inflammation and suppress an innate Type 2 response in vivo. Extracellular vesicles are emerging as a central mechanism for cell-to-cell signalling within mammalian systems, and our report of their secretion by a nematode species is within the setting of vesicle secretion by an increasingly diverse range of pathogens. We have demonstrated for the first time that nematode-derived RNAs are a key component within exosomes that can be transferred to host cells. Nematodes are ubiquitous pathogens of both plants and animals and we anticipate that RNA secretion is a conserved phenomenon, supported by the fact that we detect miRNAs from the filarial nematode L.

Sigmodontis in host tissue, consistent with a recent report. In fact, RNA secretion may be a ubiquitous feature across a range of parasites; an initial report suggests that miRNAs are also associated with vesicles in the trematode Dicrocoelium dendriticum.Given that many of the nematode miRNAs are homologues to mouse miRNAs, it is tempting to speculate that these could tap into existing miRNA regulatory networks in host cells. In support of this, we show with a reporter assay that three of the secreted nematode miRNAs that have identical seed sites to mouse miRNAs can together downregulate DUSP1 through conserved sites in its 3′UTR. Many questions remain, however, regarding the mechanism by which the nematode miRNAs can operate in host cells. The exosome is a functional ensemble and immune suppression is likely to require a combination of protein and miRNAs for fusion and gene regulation. It will be challenging, therefore, to pin point the individual contributions of each. For example, a nematode Ago protein is secreted with the miRNAs that may be required for functionality.

This Ago belongs to the WAGO clade of Agos that evolved in the nematode lineage. The WAGOs mediate diverse RNA interference mechanisms in nematodes and can operate at epigenetic, transcriptional and post-transcriptional levels; it is intriguing to now consider how these possibilities could extend to their hosts.An exciting finding in this study is the fact that the exosomes can suppress an innate Type 2 response in vivo, identifying vesicles as another class of immunomodulator used by the parasite and opening the door to further exploitation of exosomes in a therapeutic context. Our previous work has shown that H. Polygyrus-secreted material suppresses IL-33 release and it is likely that a combination of soluble proteins and exosomes together suppress this important pathway. From analyses in vitro we identify Il33r and Dusp1 as host genes directly suppressed by the exosomes. Although DUSP1 has been broadly viewed as an attenuator of immune activation, it is known to preferentially downregulate IL-6 that has recently been shown to promote susceptibility to H.

Polygyrus, while upregulating IL-10, which acts as a broadly immunosuppressive cytokine. Hence, parasite survival is likely to be favoured by reduced DUSP1 levels. Further, DUSP1/MKP-1 dampens the acute inflammatory response to lipopolysaccharide, promoting macrophage arginase expression over nitric oxide synthase. Hence, parasite repression of DUSP1 could block the induction of arginase, a known mediator of killing of H. Polygyrus in the mouse. These possibilities are now being investigated in our laboratories.

Our reporter assays suggest that Dusp1 could be directly targeted by the parasite miRNAs; however, we do not observe repression of Il33r when transfecting the parasite miRNA, miR-71, that is predicted to target its 3′UTR. It may be that additional parasite-derived RNAs or proteins could regulate Il33r expression, or that the effect operates indirectly through a separate target gene. For example, reduced expression of Dusp1 or other regulators of MAPK signalling could result in GATA-2 phosphorylation, which might inhibit its ability to promote Il33r transcription.Finally, our work has revealed not only secreted miRNAs that are packaged in exosomes but also full-length Y RNAs that are transferred to host cells at an abundance level detectable by northern blot analysis.

Y RNAs are not known to function in gene silencing but were recently shown to be packaged into exosomes secreted from dendritic cells and play roles in RNA quality control and DNA replication in humans. Further work is required to understand whether and how each of these classes of secreted parasite RNA can contribute to the capacity of this parasite to manipulate its environment within the host. Purification of vesicles from secretion productFor collection of H.

Polygyrus secretion product, CF1 mice are infected with infective-stage larvae by gavage and adult parasites collected from the small intestine 14 days post infection. The worms are maintained in serum-free media in vitro as described elsewhere; secretion product is collected every 3 days for a maximum of 3 weeks (samples used here were from the first week of collection) and purified as follows: eggs are removed by spinning at 400 g before filtering of the secretion through 0.2-μm filter (Millipore). Filtered media is then processed following a modified protocol from that described in ref., by being spun at 100,000 g for 2 h in polyallomer tubes at 4 °C in a SW40 rotor (Beckman Coulter). Pelleted material is washed two times in filtered PBS at 100,000 g for 2 h. The supernatant is concentrated using Vivaspin 6 5000 MWCO tubes (Fisher) at 5,000 g and washed two times with PBS. Small RNA library preparation and analysisFor the analysis of small RNAs in the life stages and total secretion products, total RNA was size-selected on 15% denaturing PAGE and libraries prepared from the 18 to 30 nt fraction using Illumina Small RNA preparation kit version 1.5 and sequenced on an Illumina GAIIX instrument in Edinburgh Genomics ( ).

To identify larger RNAs in the secretion product, separate libraries were also prepared for RNA size selected between 60 and 100 nt and sequenced in parallel. For analysis of vesicle and nonvesicle fractions, small RNA libraries were prepared using the TruSeq kit and sequenced on MiSeq platforms, without prior size fractionation of the RNA. All libraries were analysed by first clipping the 3′ sRNA adapter using cutadapt, searching for at least a six-base match to the adapter sequence.

For analysis of small RNAs only reads that contained the adapter were 16–40 nt in length and were present at more than two copies were retained for further analysis. For analysis of RNAs 60 nt in the secretion product, sequences present at 100 reads in the library (out of 490,614 reads sequenced) were aligned in Clustalw and manually inspected for sbRNA (Y RNA) content in terms of secondary structure and location of a UUAUC motif in the terminal loop as described in ( and ). The Y fragments in the small RNA libraries (. PCp end labelling and northern blotFor 3′ end-labelling, total RNA was extracted from the life stages and secretion product using the miRNAeasy kit (Qiagen): 1 μg total RNA was used from life stages and RNA extracted from a volume of secretion product equating to 15 μg protein (the total RNA concentration was too low to detect by nanodrop or qubit). The 3′-end labelling was carried out at 4 °C overnight in 10 μl using RNA ligase I (NEB) according to the manufacturer’s instructions with 3,000 Ci mmol −1 32P PcP (Perkin Elmer). Reactions were quenched by the addition of 2 × loading buffer (8 M urea, 0.5% TBE) and 4 μl run on an 18% PAGE at 350 V for 8 h, which was then visualized by phosphorimaging using a Typhoon Scanner (GE Healthcare). For northern blot analysis, total RNA was extracted from volumes of vesicle and nonvesicle fractions that contained equivalent protein (10 μg) and then separated by denaturing 15% PAGE, transferred to Hybond-N+ membrane (GE Healthcare) and chemically crosslinked as described previously.

Blots were prehybridized in PerfectHyb (Sigma) for 1 h at 42 °C before overnight incubation with DNA probes (Invitrogen) that were perfectly complementary to the miRNA or Y RNA: miR-100: 5′-ACACAAGTTCGGATCTACGGGTT-3′, YRNA-5P: 5′-ACCCTACGACTCCGGACCAAGCGCG-3′, YRNA-3P: 5p-GCGCCGGTCGAGCTTTTGTCGAAGGGAAT-3p, Y RNA-loop: 5p-AAGGGAATTCGAGACATTGTTGATAAC-3p. The probes were labelled with T4 PNK (NEB) and 6,000 Ci mmol −1 32P ATP (Perkin Elmer) according to the manufacturers’ protocols.

MiRNA RT–qPCRAnalysis of miRNA levels in ultracentrifugation fractions was carried out using the miScript system (Qiagen) with unmodified DNA probes identical to the full-length parasite miRNA (Life Sciences): miR-100: 5′-AACCCGTAGATCCGAACTTGTGT-3′, miR-71: 5′-TGAAAGACATGGGTAGTGAGAC-3′, let-7: 5′-TGAGGTAGTAGGTTGTATAGTT-3′ and miR-60: 5′-TATTATGCACATTTTCTGGTTCA-3′. For analysis of parasite-derived miRNA levels in host cells, qRT–PCR was carried out using the miRCURY LNA microRNA PCR system (Exiqon) and LNA probes were custom-designed by Exiqon to minimize cross hybridization with mouse sequences, and efficiency of probes was measured between 90 and 100% (data not shown). Analysis of mouse gene expression levels was carried out using the Sybr green I master mix (Roche), with the following primers: gapdhF: 5′-CATGGCCTTCCGTGTTCCTA-3′, gapdhR: 5′-GCGGCACGTCAGATCCA-3′ Dusp1F: 5′-GTGCCTGACAGTGCAGAATC-3′, Dusp1R: 5′-CACTGCCCAGGTACAGGAAG-3′, Il33RF: 5′-AGACCTGTTACCTGGGCAAG-3′, Il33RR: 5′-CACCTGTCTTCTGCTATTCTGG-3′. Data were collected on a Light Cycler 480 System (Roche) following temperature profiles recommended by each manufacturer.

The delta C t method was used for quantification as described in ref. Using GAPDH as the normalizer. Data were analysed using one-way analysis of variance (ANOVA) followed by Tukey’s post test and variance within groups assessed by Brown Forsythe test. LC-MS/MSFive micrograms of total protein from the secretion product ultracentrifuge pellet or supernatant were loaded on a 12% Tris-Bis NuPAGE gel (Invitrogen) and electrophoresis carried out for 5 min before in-gel digestion as described in ref. Capillary-HPLC-MS/MS analysis was performed using an online system consisting of a micropump (1,200 binary HPLC system, Agilent, UK) coupled to a hybrid LTQ-Orbitrap XL instrument (ThermoFisher, UK). Data were searched using MASCOT Versions 2.4 (Matrix Science Ltd, UK) against an in-house H.

Polygyrus transcriptome assembly of 454 sequences using a maximum missed-cut value of 2. Variable methionine oxidation and fixed cysteine carbamidomethylation were used in all searches; precursor mass tolerance was set to 7 p.p.m. And MS/MS tolerance to 0.4 a.m.u.

The significance threshold ( p) was set below 0.05 (MudPIT scoring). A peptide Mascot score threshold of 20 was used in the final analysis, which corresponds to a global FDR of 4.6% using a decoy database search. LC-MS label-free quantitation was performed using Progenesis (Nonlinear Dynamics, UK) as described elsewhere where the total number of Features (that is, intensity signal at a given retention time and m/z) was reduced to MS/MS peaks with the charge of 2, 3 or 4+ and we only kept the five most intense MS/MS spectra per ‘Feature’.

The subset of multicharged ions (2+, 3+ and 4+) was extracted from each LC-MS run. For a specific protein, the associated unique peptide ions were summed to generate an abundance value that was transformed using an ArcSinH function required for the calculation of the P value. A total of 362 proteins were identified in either the supernatant or pellet based on requirement of at least two peptides present; of these, 122 were enriched in the supernatant and 139 in the pellet, while the remaining 101 did not show statistically significant enrichment and were detectable in both samples.

The within-group means were calculated to determine the fold change and the transformed data were then used to calculate the P values using one-way ANOVA. Differentially expressed proteins were considered meaningful under the following conditions: detected by two or more peptides, with an absolute ratio of at least 1.5 and P. TEMFor visualization of the vesicles, the purified ultracentrifuged pellet from H. Polygyrus secretion product (100 μg ml −1 protein concentration) was fixed in 2% paraformaldehyde (PFA), deposited on Formvar-carbon-coated EM grids and treated with glutaraldehyde before treatment with uranyl oxalate and methyl cellulose as described in ref.

For analysis of adult H. Polygyrus parasites, samples were washed with PBS before fixation in 2.5% glutaraldehyde solution in 0.1 M sodium cacodylate buffer overnight. Parasites were rinsed three times with 0.1 M Na cacodylate buffer, and post-fixed in 1% osmium tetroxide for 1 h. After rinsing in 0.1 M Na cacodylate buffer, they were sequentially dehydrated in a graded acetone series.

Finally, samples were sequentially incubated for 30 min in an araldite:acetone solution left to evaporate overnight at 60 °C and then embedded in fresh araldite resin and polymerized at 60 °C for 48 h. Ultrathin sections, 60-nm thick, were cut from selected areas, stained in uranyl acetate and lead citrate, and then viewed in a Philips CM120 TEM. Images were taken on a Gatan Orius CCD camera. Flow cytometry and confocal analyses of uptakePurified exosomes from H. Polygyrus or MODE-K cells (measured as 5 μg of total protein) were labelled with 2 μg of PKH67 dye (Sigma) for 5 min at room temperature following the manufacturer’s protocol.

The staining reaction was stopped by adding an equal amount of 1% bovine serum albumin (BSA), and exosomes were washed in PBS and pelleted by ultracentrifugation (1 h at 100,000 g). A probe solution was prepared with the PKH67 following the same protocol but mixed with PBS solution in the absence of exosomes. MODE-K cells were obtained from Dominique Kaiserlian (INSERM) and grown following the standard protocol in DMEM (Invitrogen) medium supplemented with 10% fetal bovine serum (Invitrogen), 1% penicillin–streptomycin (Lonza), 1% L-glutamine (Lonza), 1% non-essential amino acids/sodium pyruvate (Gibco). These were mycoplasma-free based on testing every 4 weeks. On the day of the experiment, cells were seeded in 24-well plates (1 × 10 5 cells per well) using advanced DMEM serum-free medium (Invitrogen) supplemented with 1% L-glutamine and subsequently incubated (1 h at 37 °C) either in the presence of PKH67-labelled H.

Polygyrus-derived exosomes (5 μg of total protein) or in the presence of the probe alone. After incubation, cells were harvested, washed twice in FACS buffer (PBS 1 ×, 2.5% FBS, 0.1% BSA, 0.05% NaN 3) and finally resuspended in 500 μl of the same buffer. A subset of the samples were then incubated with 50 ul of 0.25% Trypsin/EDTA (Gibco) for 5 min before analysis (indicated in ).

Samples were analysed using the BD FACS Canto II flow cytometer (BD Bioscience). Data files were acquired from the cytometer, with 5,000 events collected for each tube and the data analysis was performed using the FlowJo software (Tree Star Inc.).

For confocal analyses, MODE-K cells were seeded on round microscope cover glasses in 24-well plates (2.5 × 10 4 cells per well) in media described above. Cells were allowed to attach on to the coverslips overnight and the following day shifted to advanced DMEM medium supplemented with 1% L-glutamine. Cells were incubated (1 h at 37 or 4 °C) either in the presence of labelled exosomes or probe only. After incubation, medium was aspirated, cells were washed twice in PBS and fixed with 4% PFA, with residual PFA quenched with 50 mM glycine. Slide coverslips were washed extensively in PBS, and nuclei were stained with 4',6-diamidino-2-phenylindole-supplemented ProLong Fade Gold (Invitrogen) mounting media. Samples were examined on the Leica SP5 II (Leica Microsystems, lasers exciting at 405 and 488, × 63 objective) using the LAS AP software (Leica). Images were analysed using the Volocity software (Improvision).

Microarray analysisMODE-K cells were grown in DMEM media as described above and seeded into 24-well plates at 20,000 cells per well. The following day, cells were incubated with H. Polygyrus-derived exosomes (5 μg total protein per well) for 20 h before washing twice with PBS and total RNA extracted. RNA was prepared for microarray analysis using the Illumina TotalPrep RNA Amplification kit and run on MouseWG-6 v2.0 (Illumina) at the Wellcome Trust Clinical Research Facility (University of Edinburgh).

The raw SampleProbeProfile file was processed within R, using ‘lumi’ and ‘lumiMouseAll.db’ Bioconductor packages. Quality control was performed using Multi-Dimensional Scaling, and one of the control samples that behaved as an outlier was removed.

Raw expression values were processed with the Variance Stabilizing Transformation and the Robust Spline Normalization. An InterQuartile Range was calculated across all samples for each probe, and used to select the most variable probe of those that mapped to the same transcript. Probes without a gene or transcript annotation were excluded, leaving a total of 30,708 nonredundant annotated probes. Differential expression was performed using the ‘limma’ package, fitting a linear model for each probe and using an empirical Bayes method to obtain moderated t-statistics. In order to reduce the multiple-test problem and focus on the most interesting genes, ‘present’ probes with an Illumina detection P value. In vivo analysis of exosome function in Alternaria modelBALB/c mice were bred in-house at the University of Edinburgh and accommodated according to Home Office regulations. Female mice were used when they were 6–10 weeks old.

For all experiments presented in this study, the sample size was large enough to measure the effect size. No randomization and no blinding were performed in this study.

Polygyrus exosomes (10 μg) were administered intranasally (under isoflurane sedation) in 50 μl PBS, or 50 μl PBS alone to controls, 24 h before intranasal administration of 50 μg Alternaria extract with a further 5 μg of exosomes. Mice were killed 24 h after Alternaria administration, and bronchoalveolar lavage and lung cell suspensions stained for flow cytometry as described previously. Briefly, cells were counted, then surface stained for Siglecf+CD11c− (eosinophils) or stimulated with phorbol myristate acetate (PMA) and ionomycin for 4 h in the presence of BrefeldinA and surface stained as negative for lineage markers (CD3/CD4/CD5/CD19/CD11b/CD11c/CD19/GR1) and positive for CD45, ICOS and ST2 (ILC2s), and assessed for staining of IL-5 and IL-13. Samples were acquired on a Becton-Dickinson LSRII flow cytometer.Data were analysed using Prism 6 (Graphpad Prism, La Jolla, CA, USA). Variance within groups was assessed by Brown Forsythe test and data were log-transformed and analysed by one-way ANOVA, with a Tukey’s multiple comparisons post test. Unless otherwise indicated, differences are not significant. Luciferase assaysThe 3′UTRs of Dusp1 and Il33r were cloned behind Renilla luciferase in the Psicheck2 vector (Promega) at NotI and XhoI restriction sites as described in ref.

Using the following primers: Psi-DuspF: 5′-CTTTACTCGAGAGGTGTGGAGTTTCACTTGC-3′, Psi-DuspR: 5′-CTTTAGCGGCCGCAGCTACAAACCTACACTGGC-3′, Psi-Il33rF: 5′-CTTTACTCGAGGACTGTGTGTTGTAGCTTGG-3′, Psi-Il33rR: 5′-CTTTAGCGGCCGCCAGAGGGAGGCTTTATAAGG-3′.For reporter assays, 15,000 cells were reverse transfected into a 96-well plate with 0.3% lipofectamine (Invitrogen) and 50 ng of each Psicheck reporter in the absence or presence of 50 nM synthetic miRNA mimic (Thermofisher). Luciferase measurements were carried out at 48 h post transfection, using the Dual Glo Luciferase assay system (Promega) and Luminensence measured on a Varioskan plate reader (Thermofisher). Data shown in represent n=3 replicates (separate transfection experiments of the MODE-K cell line) measured in parallel to control for consistent Renilla and Luciferase ratios using the same kit; data were analysed by one-way ANOVA, with a Dunnett’s post test,.

P. MicroRNA target predictionA custom Perl script was used to identify seed-matching sites for the H. Polygyrus miRNAs identified by sRNA-Seq. All the 3′UTR sequences corresponding to probes on the microarray were scanned, and the results were passed to the TargetScan (v6.2) context scores Perl script. Targets for each miRNA were ranked by ‘Context+ Scores’. Conservation scores for relevant 3′UTRs (Dusp1 and Il33r) were obtained from the UCSC Genome Browser, using the ‘rtracklayer’ package to access the ‘phastCons60wayPlacental’ table.

Sequencing analysis of serum from infected miceF1 mice were infected with H. Polygyrus (400 L3 larvae introduced by oral gavage) and serum collected on day 14 post infection.

The presence of adult parasites was confirmed by visual inspection of the mouse gut lumen. Six-week-old BALB/c mice were infected with L. Sigmodontis (subcutaneous inoculation of 40 L3), and gel-separated serum (BD Microtainer) was collected by arterial exsanguination at 60 days post infection, which was confirmed by detection of adult worms in the mouse pleural cavity and microfilarie in peripheral blood. For library preparation, 200 μl of serum was extracted with the miRNAeasy kit (Qiagen) and libraries generated following the Trueseq protocol and sequenced on the Illumina Rapid HighSeq in Edinburgh Genomics. Data were processed as described above and analysed for perfect alignment to the mouse or L. Sigmodontis genome (reads mapping to both genomes were not analysed). Reads that aligned were then categorized by matches to Rfam or prediction as miRNAs with miRdeep2, as described in ref.

Author contributionsA.H.B. Designed and carried out RNAseq experiments and validation, identified vesicles in secretion, co-designed and contributed to analysis of serum and proteomic data, co-supervised functional and uptake assays and wrote the paper; G.C. Co-designed and carried out functional analyses, in vivo Alternaria extract experiments and vesicle detection in nematodes; F.S. Designed and carried out uptake and functional assays; S.K. Carried out genome alignment/annotation; H.M. Co-designed and performed in vivo Alternaria extract experiments; J.Q. Prepared and co-analysed serum libraries, T.L.B.

Carried out LC-MS/MS and analysis; C.A.-G. Analysed microarray data and target prediction; M.L. Purified secretion material and supported functional studies; Y.H.

Generated worm and secretion samples; A.C. Supported uptake and reporter assays; M.B. Oversaw genome assembly and phylogenetic analyses of AGO protein; S.A.B. Performed the L.

Sigmodontis infections and tissue sampling; A.I. Analysed small RNAseq data; R.M.M. Polygyrus life stage material, contributed to analysis of proteomic data, co-designed immunological experiments and edited the manuscript. Additional informationHow to cite this article: Buck, A. Exosomes secreted by nematode parasites transfer small RNAs to mammalian cells and modulate innate immunity. 5:5488 doi: 10.1038/ncomms6488 (2014).Accession codes: The sequencing and microarray data from this study have been deposited in Gene Expression Omnibus ( ) under accession codes.

The novel miRNA sequences identified in this study have been deposited in miRBase and the official naming is provided in Supplementary Data 1. The genomic information for H. Polygyrus and L. Sigmodontis is available at. Claycomb, K.A. Smith and J.P. Hewitson for many helpful discussions, E.

Robertson for maintaining the H. Polygyrus life cycle, A. Fulton for maintaining the L. Sigmodontis life cycle, S. Mitchell for technical support for TEM and U. Bridgett and Edinburgh Genomics for H. Polygyrus genome assembly.

The MODE-K cells were provided by D. Kaiserlian (INSERM). We thank the Wellcome Trust for funding through a Research Career Development Fellowship to AHB, a Programme Grant to RMM, and funding to the Centre for Immunity, Infection and Evolution and Asthma UK for fellowship funding to HJMcS. A molecular evolutionary framework for the phylum Nematoda. Nature 392, 71–75 (1998).

Finney C. A., Taylor M. D., Wilson M. M.Expansion and activation of CD4(+)CD25(+) regulatory T cells in Heligmosomoides polygyrus infection. 37, 1874–1886 (2007). Mohrs K., Harris D.

& Mohrs M.Systemic dissemination and persistence of Th2 and type 2 cells in response to infection with a strictly enteric nematode parasite. 175, 5306–5313 (2005). Rausch S.et al. Functional analysis of effector and regulatory T cells in a parasitic nematode infection. 76, 1908–1919 (2008). McSorley H. M.Helminth infections and host immune regulation.

25, 585–608 (2012). Grainger J. Helminth secretions induce de novo T cell Foxp3 expression and regulatory function through the TGF-beta pathway. 207, 2331–2341 (2010). Maizels R. Immune modulation and modulators in Heligmosomoides polygyrus infection.

132, 76–89 (2012). Turchinovich A., Samatov T. R., Tonevitsky A. & Burwinkel B.Circulating miRNAs: cell-cell communication function? 4, 119 (2013).

Zhang L.et al. Exogenous plant MIR168a specifically targets mammalian LDLRAP1: evidence of cross-kingdom regulation by microRNA. 22, 107–126 (2012). Wang K.et al.

The complex exogenous RNA spectra in human plasma: an interface with human gut biota? PLoS ONE 7, e51009 (2012). Hoy A. Parasite-derived microRNAs in host serum as novel biomarkers of helminth infection. 8, e2701 (2014). Tritten L.et al. Detection of circulating parasite-derived microRNAs in filarial infections.

8, e2971 (2014). Hoy A. H.Extracellular small RNAs: what, where, why? 40, 886–890 (2012). Thery C.et al. Proteomic analysis of dendritic cell-derived exosomes: a secreted subcellular compartment distinct from apoptotic vesicles.

166, 7309–7318 (2001). Baietti M. Syndecan-syntenin-ALIX regulates the biogenesis of exosomes. 14, 677–685 (2012). Boria I.et al. Nematode sbRNAs: homologs of vertebrate Y RNAs.

70, 346–358 (2010). Alvarez-Saavedra E. R.Many families of C. Elegans microRNAs are not essential for development or viability. 20, 367–373 (2010). Tarver J. MiRNAs: small genes with big potential in metazoan phylogenetics.

30, 2369–2382 (2013). Mathivanan S. J.ExoCarta: a compendium of exosomal proteins and RNA. Proteomics 9, 4997–5000 (2009).

Hewitson J. Proteomic analysis of secretory products from the model gastrointestinal nematode Heligmosomoides polygyrus reveals dominance of venom allergen-like (VAL) proteins. 74, 1573–1594 (2011).

In the side-scrolling action game Sonic Adventure DX, six characters-Sonic the Hedgehog, Tails the Fox, Knuckles the Echidna, Amy Rose, Big the Cat, and a robot named E-102-tackle a variety of. Hit the ground running in this classic epic adventure in a race against time to save the world! Features Six Characters, Six Adventures. Play through as one of six different characters, including Sonic, Tails, Knuckles, and Amy, each with their own unique adventure and story. Breed a Pet Chao. Sonic Adventure ROM download is available to play for Dreamcast. This Sonic game is the US English version at EmulatorGames.net exclusively. Download Sonic Adventure ROM and use it with an emulator. Play online Dreamcast game on desktop PC, mobile, and tablets in maximum quality. Sonic adventure download dreamcast. The real joy of Sonic Adventure is that you can't put down the controller. The adventure draws you into the chaotic, expansive world of Sonic and his friends, perhaps even bringing a nostalgic tear of joy to an old-schoolers eye. Sonic is fun, fast, and a great reason to purchase a Dreamcast. Run, don't walk, and jump into Sonic's new Adventure.

Toedling J.et al. Deep-sequencing protocols influence the results obtained in small-RNA sequencing. PLoS ONE 7, e32724 (2012). McSorley H. A., McKenzie A. M.Blockade of IL-33 release and suppression of type 2 innate lymphoid cell responses by helminth secreted products in airway allergy. Mucosal Immunol.

7, 1068–1078 (2014). Humphreys N. E., Xu D., Hepworth M. K.IL-33, a potent inducer of adaptive immunity to intestinal nematodes. 180, 2443–2449 (2008).

Twu O.et al. Trichomonas vaginalis exosomes deliver cargo to host cells and mediate hostratioparasite interactions. 9, e1003482 (2013).

Silverman J. An exosome-based secretion pathway is responsible for protein export from Leishmania and communication with macrophages. 123, 842–852 (2010). Marcilla A.et al. Extracellular vesicles from parasitic helminths contain specific excretory/secretory proteins and are internalized in intestinal host cells. PLoS ONE 7, e45974 (2012). Bernal D.et al.

Surface analysis of Dicrocoelium dendriticum. The molecular characterization of exosomes reveals the presence of miRNAs. 105, 232–241 (2014). Buck A. & Blaxter M.Functional diversification of Argonautes in nematodes: an expanding universe. 41, 881–886 (2013).

Smith K. M.IL-6 controls susceptibility to helminth infection by impeding Th2 responsiveness and altering the Treg phenotype in vivo.

44, 150–161 (2014). Hammer M.et al. Dual specificity phosphatase 1 (DUSP1) regulates a subset of LPS-induced genes and protects mice from lethal endotoxin shock. 203, 15–20 (2006). Nelin L. MKP-1 switches arginine metabolism from nitric oxide synthase to arginase following endotoxin challenge. Cell Physiol.

293, C632–C640 (2007). Anthony R. Memory T(H)2 cells induce alternatively activated macrophages to mediate protection against nematode parasites. 12, 955–960 (2006).

Baba Y.et al. GATA2 is a critical transactivator for the human IL1RL1/ST2 promoter in mast cells/basophils: opposing roles for GATA2 and GATA1 in human IL1RL1/ST2 gene expression. 287, 6 (2012). Towatari M.et al. Regulation of GATA-2 phosphorylation by mitogen-activated protein kinase and interleukin-3.

270, 4101–4107 (1995). Nolte-'t Hoen E. Deep sequencing of RNA from immune cell-derived vesicles uncovers the selective incorporation of small non-coding RNA biotypes with potential regulatory functions. Nucleic Acids Res. 40, 9272–9285 (2012). Nicolas F. E., Csorba T., Turnbull C.

& Dalmay T.Biogenesis of Y RNA-derived small RNAs is independent of the microRNA pathway. 586, 1226–1230 (2012). Harcus Y.et al.

C-type lectins from the nematode parasites Heligmosomoides polygyrus and Nippostrongylus brasiliensis. 58, 461–470 (2009). Thery C., Amigorena S., Raposo G.

& Clayton A.Current Protocols in Cell Bio logy Ch. 3 (eds Bonifacino J. Et al.)3.22.1–3.22.29 (John Wiley & Sons, (2006). Ruby J.

Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. Cell 127, 1193–1207 (2006). Friedlander M. R., Mackowiak S.

D., Li N., Chen W. & Rajewsky N.miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades. Nucleic Acids Res. 40, 37–52 (2012). Libri V.et al. Murine cytomegalovirus encodes a miR-27 inhibitor disguised as a target. USA 109, 279–284 (2012).

Le Bihan T.et al. Shotgun proteomic analysis of the unicellular alga Ostreococcus tauri.

74, 2060–2070 (2011). Hewitson J. Secretion of protective antigens by tissue-stage nematode larvae revealed by proteomic analysis and vaccination-induced sterile immunity. 9, e1003492 (2013).

Yin Y.et al. Intestinal transcriptomes of nematodes: comparison of the parasites Ascaris suum and Haemonchus contortus with the free-living Caenorhabditis elegans. 2, e269 (2008). Vidal K., Grosjean I., evillard J.

P., Gespach C. & Kaiserlian D.Immortalization of mouse intestinal epithelial cells by the SV40-large T gene. Phenotypic and immune characterization of the MODE-K cell line. Methods 166, 63–73 (1993). Team, R.D.C. A language and environment for statistical computing (2010) ). Gentleman R.

Bioconductor: open software development for computational biology and bioinformatics. 5, R80 (2004). Du P., Kibbe W. M.lumi: a pipeline for processing Illumina microarray.

Bioinformatics 24, 1547–1548 (2008). Lin S. M., Du P., Huber W.

A.Model-based variance-stabilizing transformation for Illumina microarray data. Nucleic Acids Res. 36, e11 (2008). Smyth G.

K.Linear models and empirical bayes methods for assessing differential expression in microarray experiments. 3, Article3 (2004). Benjamini Y. HochbergControlling the false discovery rate: a practical and powerful approach to multiple testing. 57, 289–300 (1995). Karolchik D.et al. The UCSC genome browser database: 2014 update.

Nucleic Acids Res. 42, D764–D770 (2014). Lawrence M., Gentleman R. & Carey V.rtracklayer: an R package for interfacing with genome browsers. Bioinformatics 25, 1841–1842 (2009).

The Nizam during his youth.Mir Osman Ali Khan Siddiqi, Asaf Jah VII (6 April 1886 – 24 February 1967), was the last (ruler) of the of, the largest princely state in. He ascended the throne on 11th August, 1911, at the age of 25 and ruled Hyderabad between 1911 and 1948, until it was. He was styled as the. He was one of the.

In 1937, he was featured on the cover of magazine as the richest person at the time. He was the 5th richest man in history of mankind and the richest Indian who ever lived.On taking the throne, he studied and understood all the State papers that his father sent to him.He was a benevolent ruler who patronised education, science and development. During his 37-year rule, electricity was introduced, railways, roads and airways were developed. He is credited with the establishment of numerous public institutions in the city of Hyderabad, including the, and to name a few. Two reservoirs, namely and were built during his reign, to prevent another in the city.He was also a philanthropist, donating millions of rupees to various educational and religious institutions all over India.

Apart from his wealth, he was known for his eccentricities, as he used to knit his own socks, and borrow cigarettes from guests.The Nizam originally wanted to join India. However, after India's, the Nizam did not wish to accede his state to the newly formed nation. By then, his power had weakened due to the and rise of a radical militia known as the. In 1948, the Indian Army, and the Nizam had to surrender.

Post independence, he became the of between 1950 and 1956, after which the state was partitioned and became part of,. The Nizam died in 1967. See also:The infamous mines of Golconda were the major source of wealth for the Nizam's, with the being the only supplier of for the global market in the 18th century.Mir Osman Ali Khan acceded as the Nizam of Hyderabad upon the death of his father in 1911. The state of Hyderabad was the largest of the princely states in.

With an area of 86,000 square miles (223,000 km²), it was roughly the size of the present-day. The Nizam was the highest-ranking prince in India, was one of only five princes, held the unique title of 'Nizam', and was titled ' and 'Faithful Ally of the ' Early years (1911 to 1918) In 1908, three years before the Nizam's coronation, the city of Hyderabad was that resulted in the death of thousands. The Nizam, on the advice of, ordered the construction of two large reservoirs, namely the Osman Sagar and Himayat Sagar to prevent another flood.He was given the title of 'Faithful Ally of the ' after due to his financial contribution to the 's war effort.

(For example, 's original complement of aircraft were Osman Ali's gift. Each aircraft bore an inscription to that effect, and the unit became known as the 'Hyderabad Squadron'.

) He also paid for a vessel, the, commissioned in 1940 and transferred to the.In 1918, the Nizam issued a that brought into existence the, the first university to have as a medium of instruction. The present campus was completed in 1934.

Post-World War (1918 to 1939) In 1919, the Nizam ordered the formation of the Executive Council of Hyderabad, presided by Sir Sayyid Ali Imam, and with eight other members, each in charge of one or more departments. The President of the Executive Council would also be the.The was established in the 1930s with formation of by the Nizam. Initially it was used as a domestic and international airport for the Nizam's, the earliest airline in British India. The terminal building was created in 1937. Final years of reign (1939 to 1948).

The Nizam with his subjects ( and to his right)He arranged a matrimonial alliance between his first son and of the. It was believed at that time that the matrimonial alliance between the Nizam and the would lead to the emergence of a Muslim ruler who could be acceptable to the world powers in place of the.

After India's Independence, the Nizam made vain attempts to declare his sovereignty over the state of Hyderabad, either as a protectorate of the, or as a sovereign monarchy. However, his power weakened due to the and rise of the, a radical Muslim militia who wanted Hyderabad to remain under Muslim rule. In 1948, India Hyderabad State, and the rule of the Nizam ended wherein the Nizam became the and served from 26 January 1950 to 31 October 1956. Contributions to society Construction of major public buildings Nearly all the major public buildings and institutions in Hyderabad city, such as, Asafiya Library now known as the, now known as the Assembly Hall, Hyderabad Museum now known as the and many other monuments were built under his reign. He also built the in, now used for diplomatic meetings by the Government of India. Educational reforms From giving donations to major educational institutions throughout India, he introduced many educational reforms during his reign.

Almost 11% of the Nizam's budget was spent on education.He made large donations to many institutions in India and abroad with special emphasis given to educational institutions such as the and the.Osmania University. Main article:In 1941, he started his own bank, the 'Hyderabad State Bank' (later renamed and, in 2017, merged into the ) as the state's central bank. It was established on 8 August 1941 under the Hyderabad State Bank Act. The bank managed the 'Osmania Sikka', the currency of the state of.

It was the only state in India which had, the. Hyderabad was the only state in British India where the ruler was allowed to issue currency notes. In 1953, the bank absorbed, by merger, the Mercantile Bank of Hyderabad, which Raja Pannalal Pitti had founded in 1935.In 1956, the Reserve Bank of India took over the bank as its first subsidiary and renamed it State Bank of Hyderabad. The Subsidiary Banks Act was passed in 1959. On 1 October 1959, SBH and the other banks of the princely states became subsidiaries of SBI. It merged with SBI on 31 March 2017.Flood prevention After the, which killed an estimated 50,000 people, the Nizam constructed 2 lakes to prevent another great flood, namely.

The former was named after himself, and the latter after his son (Azam Jah).Agricultural reforms The foundation of agricultural research in region of erstwhile Hyderabad State was laid by the Nizam with the commencement of the Main Experimental Farm in 1918 in. During the Nizam's rule agricultural education was available only at; crop research centres for sorghum, cotton and fruits existed in Parbhani.

After, this facility was developed further by the Indian government which was renamed as on 18 May 1972. Contribution to Indian aviation India's first airport - the was established in the 1930s with the formation of the Hyderabad Aero Club by Nizam.Initially it was used as a domestic and international airport by Nizam and was known as ' - the first airline during British India. The airport building was built in 1937.Wealth. Main article:The Nizam possessed such enormous wealth that he was portrayed on the cover of on 22 February 1937, being described as the world's richest man. He used the, a 185-carat diamond that is part of the, a precious collection running into several thousand crores of rupees today, as a paperweight.

During his days as Nizam, he was reputed to be, having a fortune estimated at US$2 billion in the early 1940s ($36.5 billion today) or 2 per cent of the US economy then. At that time the treasury of the newly independent Union government of India reported annual revenue of US$1 billion only.The Nizam is known to have remained as the richest man in South Asia until his death in 1967, but his fortunes fell to US$1 billion by then as more than 97% of his wealth, including jewellery belonging to his family including his daughter's and grand daughters, was taken away by the newly formed Indian Government. Just prior to his death, the Nizam's personal fortune was roughly estimated to be £110 million, including £40 million in gold and jewels (equivalent to £2,145,498,339 in 2019),.The Indian government still exhibits the jewellery as (now in Delhi).

There are 173 jewels, which include weighing nearly 2,000 carats (0.40 kg), and exceeding 40 thousand. The collection includes, ornaments, necklaces and, and buckles, bangles and, and, and, and.Gift to Queen Elizabeth II In 1947, the Nizam made a gift of diamond jewels, including a tiara and necklace, to on the occasion of her marriage. The brooches and necklace from this gift are still worn by the Queen and is known as the.The has also been spotted wearing the necklace on a few occasions. Donations to Educational and Religious Institutions. The Nizam at the inauguration of the Arts College, c. Temples The Nizam donated Rs.82,825 to the at Bhongir, Rs.29,999 to and Rs. 8,000 to.He also donated Rs.50,000 towards the re-construction of located in the old city of Hyderabad.After hearing about the of Amritsar through Maharaja Ranjit Singh, Mir Osman Ali Khan started giving yearly grants towards it.

Educational institutions He also donated Rs 10 Lakh for the, Rs. 5 Lakh for the, and 3 lakhs for the. Donation towards compilation of Holy Mahabharata In 1932, there was a need for money for the publication of the Holy in the located in Pune. A formal request was made to the 7th Nizam (Mir Osman Ali Khan) who granted Rs.1000 per year for a period of 11 years.

He also gave Rs 50,000 for construction of the guest house which stands today as the 'Nizam Guest House'. Legend of gold donation to the National Defence Fund According to an, Nizam Mir Osman Ali Khan donated 5,000 kg of gold to the of India in the aftermath of the. The legend claims that Nizam gave the gold to Prime Minister in 1965, when the latter visited Hyderabad during an India-wide tour to raise funds for the post-war economy.

According to the story, Nizam asked only the boxes containing the gold to be returned.In reality, the Nizam did not donate 5,000 kg of gold, he invested 425 kg of gold in the National Defence Gold Scheme. The Scheme was floated by the government in October 1965 to deal with an economic crisis, and the investors were offered a 6.5% interest rate. The scheme included an amnesty clause: the gold acquired using income not disclosed to the income tax authorities was exempted from tax, if invested in the scheme. The Nizam indeed met Shastri in Hyderabad, and agreed to invest 425 kg of old gold (coins), which were valued at ₹ 5 million at the time. Shastri later thanked the Nizam at a public meeting, stating that the government planned to send these gold coins to foreign countries, expecting to obtain ₹ 10 million in return.It is not clear who received the return on this investment.

In 2018, the Nizam's grandson stated that according to his knowledge, none of the 52 trusts created by the Nizam had received any money from this investment. English-language newspaper submitted a query to the (RBI) in 2018 asking for information on the investment and the final beneficiary. However, the RBI refused to provide this information, citing 'unwarranted invasion of the privacy' clause of the RTI law. Operation Polo and forced abdication.

Main article:After Indian independence in 1947, the country was partitioned into and Pakistan. The princely states were left free to make whatever arrangement they wished with either India or Pakistan. The Nizam ruled over more than 16 million people and 82,698 square miles (214,190 km 2) of territory when the British withdrew from the sub-continent in 1947. The Nizam refused to join either India or Pakistan, preferring to form a separate independent kingdom within the British.This proposal for independence was rejected by the British government, but the Nizam continued to explore it. Towards this end, he kept up open negotiations with the Government of India regarding the modalities of a future relationship while opening covert negotiations with Pakistan in a similar vein. The Nizam cited the as evidence that the people of the state were opposed to any agreement with India.

Ultimately the new Indian government decided to invade and capture Hyderabad in 1948, in an operation code named. Under the supervision of Major General, one division of the and a tank brigade invaded Hyderabad.Title conferred The Nizam was the honorary Colonel of the 20 Deccan Horse. In 1918, Nawab Mir Osman Ali Khan Siddqi Bahadur was elevated by from His Highness to.

In a letter dated 24 January 1918, the title Faithful Ally of the British Government was conferred on him. Titular Name.

His titular name between 1941–1967 was: General His Exalted Highness Rustam-i-Dauran, Arustu-i-Zaman, Wal Mamaluk, Asaf Jah VII, Muzaffar ul-Mamaluk, Nizam ul-Mulk, Nizam ud-Daula, Nawab Mir Sir Osman 'Ali Khan Siddqi Bahadur, Sipah Salar, Fath Jang, Faithful Ally of the British Government, Nizam of Hyderabad and Berar, GCSI, GBE.Personal life. The Nizam with his heir apparent and grandsonThe Nizam lived at — bought from a nobleman—for all his life from age 13. He never moved to, even after his to the throne.Unlike his father, he was not interested in fine clothing or hunting. His hobbies rather included along the likes of poetry and writing.He revered his mother a lot, visiting her every day till she was alive; and later used to visit her grave almost every day of his life. Wives and children On 14 April 1920, the Nizam married Sahebzadi Azmath unnisa Begum (Dulhan Pasha Begum) (1889–1955), daughter of Nawab Jahangir Jung Bahadur, at Eden Bagh now known as Eden Garden at King Kothi, Hyderabad at the age of 21.

Was the first brother-in-law of the Nizam, and the uncle of his sons (1907–1970), and (1907–1987)His first son - married, daughter of (Heir to the last of the ). They had two children, and.Whereas, his 2nd son married, a princess of the.He had 34 children: 18 sons and 16 daughters. Final years and death The Nizam continued to stay at the until his death. He used to issue on inconsequential matters in his newspaper, the Nizam Gazette.He died on Friday, 24 February 1967. He had willed that he be buried in Masjid-e Judi, a mosque where his mother was buried, that faced. The government declared state mourning on 25 February 1967, the day when he was buried.

State government offices remained closed as a mark of respect while the was flown at half-mast on all the government buildings throughout the state. According to Nizam Museum documents,The streets and pavements of the city were littered with the pieces of broken glass bangles as an incalculable number of women broke their bangles in mourning, which women usually do as per Indian customs on the death of a close relative.Millions of people of all religions of different parts of the entered Hyderabad in trains, buses and bullocks to see the last glimpse of their king's mortal remains in a coffin box in the Camp in Hyderabad. The crowd was so uncontrollable that barricades were installed alongside the road to enable people to move in the queue.The Nizam's funeral procession was the biggest non-religious, non-political meeting of people in the history of India till that date.D.

Bhaskara Rao, chief curator, of the stated that an estimated one million people were part of the procession. Honours and legacy. Delhi Durbar Gold Medal, 1911.

GCSI:, 1911. GCStJ: Bailiff Grand Cross of the, 1911.

GBE:, 1917., 1935., 1937., 1946., lake, the, the of, and (an Australian Navy N-Class destroyer) were named after him.See also.References.